Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000014d0
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTACTGGCTAAATTTACAGCTG + [2234846, 2234867] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... uvrB PP_1973
Gene Locus tag Description
uvrB PP_1974 excinuclease ABC subunit B
PP_1973 PP_1973 hypothetical protein