Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001500
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCACTGTACAAAAAGACAGAGC - [2445516, 2445537] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_2142 lexA-1 PP_2144
Gene Locus tag Description
PP_2142 PP_2142 cell division inhibitor-like protein
lexA-1 PP_2143 LexA repressor
PP_2144 PP_2144 TetR family transcriptional regulator