Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001510
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATACTGTATGTGCATACAGCAA - [2799000, 2799021] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... endA-1 PP_2452 ansA PP_2450
Gene Locus tag Description
endA-1 PP_2451 deoxyribonuclease I
PP_2452 PP_2452 hypothetical protein
ansA PP_2453 type II L-asparaginase
PP_2450 PP_2450 hypothetical protein