Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001520
Genome
Pseudomonas putida - NC_002947.3
TF
LexA [UniProtKB:P0A153, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATACTGTATGAATACTCAGTAT - [3325116, 3325137] 17933893 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details PSSM site search (ECO:0005659) - 62

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_2923 PP_2924 PP_2926 mqo-3
Gene Locus tag Description
PP_2923 PP_2923 hypothetical protein
PP_2924 PP_2924 radical SAM domain-containing protein
PP_2926 PP_2926 UDP-glucose dehydrogenase
mqo-3 PP_2925 malate:quinone oxidoreductase