Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000016a0
Genome
Mycobacterium tuberculosis - NC_018143.1
TF
DosR [UniProtKB:I6XGD8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCGGGTGGATCGGGCCATC - [3500084, 3500103] 16339949 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - 67

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... RVBD_3134c RVBD_3131 RVBD_3132c RVBD_3133c RVBD_3135
Gene Locus tag Description
RVBD_3134c RVBD_3134c universal stress protein
RVBD_3131 RVBD_3131 hypothetical protein
RVBD_3132c RVBD_3132c redox sensor histidine kinase response regulator devS
RVBD_3133c RVBD_3133c transcriptional regulatory protein devR (dosR)
RVBD_3135 RVBD_3135 PPE family protein