Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000018d0
Genome
Vibrio vulnificus - NC_005140.1
TF
SmcR [UniProtKB:Q7MHU7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGAAAAAGCACAATTTTAT - [1611949, 1611968] 20110369 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 70

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VVA1465 VVA1466 VVA1467
Gene Locus tag Description
VVA1465 VVA1465 Zinc metalloprotease, vibriolysin
VVA1466 VVA1466 phosphoglycerate dehydrogenase
VVA1467 VVA1467 hypothetical protein