Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004220
Genome
Escherichia coli - NC_000913.2
TF
MntR [UniProtKB:P0A9F1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCAGACATAGCTTAGGCTATATTAC + [1903326, 1903351] 21239586 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - 162

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yobD yebN rlmA
Gene Locus tag Description
yobD b1820 inner membrane protein, UPF0266 family
yebN b1821 conserved inner membrane protein
rlmA b1822 23S rRNA m(1)G745 methyltransferase