Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000042c0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGATGTTACCAACAATGAAAGTGACACTGTCACCTTTTACCGTACTGCCGTCT + [1743155, 1743207] 18984159 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - 167

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... valW valV mdtK ydhQ
Gene Locus tag Description
valW b1666 tRNA
valV b1665 tRNA
mdtK b1663 multidrug efflux system transporter
ydhQ b1664 conserved protein