Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000042d0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCAAAAACACGGCCTGCGCTGTGCCATTGTCACTCGTGGTCAAAGCGCACTGC + [2352349, 2352401] 18984159 Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - 167

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... glpB glpA glpC
Gene Locus tag Description
glpB b2242 sn-glycerol-3-phosphate dehydrogenase (anaerobic), membrane anchor subunit
glpA b2241 sn-glycerol-3-phosphate dehydrogenase (anaerobic), large subunit, FAD/NAD(P)-binding
glpC b2243 anaerobic sn-glycerol-3-phosphate dehydrogenase, C subunit, 4Fe-4S iron-sulfur cluster