Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000042f0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGCCGCCAGCGTTTGCGCATGTGACAATTTCACATCGCTTAAACCTTCCGCCA + [2522130, 2522182] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... xapA xapB yfeN yfeR
Gene Locus tag Description
xapA b2407 purine nucleoside phosphorylase II
xapB b2406 xanthosine transporter
yfeN b2408 predicted outer membrane protein
yfeR b2409 predicted DNA-binding transcriptional regulator