Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004320
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTAGTGATATTCTTGATGCCGTGACACTGTCACTTAAAGTGGCGGCGCTGGCG + [1512958, 1513010] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydcV ydcU ydcT ydcS prr
Gene Locus tag Description
ydcV b1443 predicted spermidine/putrescine transporter subunit
ydcU b1442 predicted spermidine/putrescine transporter subunit
ydcT b1441 predicted spermidine/putrescine transporter subunit
ydcS b1440 polyhydroxybutyrate (PHB) synthase, ABC transporter periplasmic binding protein homolog
prr b1444 gamma-aminobutyraldehyde dehydrogenase