Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004330
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTCGCTGTTTACTTGTTTTGTGACACTGTCACTTGAAAGGGAGCTTCCCGCC + [1534811, 1534863] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... narW narV narY narZ
Gene Locus tag Description
narW b1466 nitrate reductase 2 (NRZ), delta subunit (assembly subunit)
narV b1465 nitrate reductase 2 (NRZ), gamma subunit
narY b1467 nitrate reductase 2 (NRZ), beta subunit
narZ b1468 nitrate reductase 2 (NRZ), alpha subunit