Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004340
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTGAAATCACAGTATTTAAGTGACAGTGTCACGTTAAATGAAAACCCGCGAG + [1561286, 1561338] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ddpX ddpA ddpB ddpC ddpD ddpF dosP dosC
Gene Locus tag Description
ddpX b1488 D-ala-D-ala dipeptidase, Zn-dependent
ddpA b1487 D-ala-D-a la transporter subunit
ddpB b1486 D-ala-D-ala transporter subunit
ddpC b1485 D-ala-D-ala transporter subunit
ddpD b1484 D,D-dipeptide permease system, ATP-binding component
ddpF b1483 D,D-dipeptide permease system, ATP-binding component
dosP b1489 oxygen sensor, c-di-GMP phosphodiesterase, heme-regulated; cold- and stationary phase-induced bioflim regulator
dosC b1490 diguanylate cyclase; cold- and stationary phase-induced oxygen-dependent biofilm regulator; positively regulates csgBAC and pgaABCD