Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004350
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTTATGTATTTTGATATTCGTGACAACGTCACCTTTTGCATCAAAAAAGTAG + [1598476, 1598528] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lsrR lsrK lsrA lsrC lsrD lsrB lsrF lsrG
Gene Locus tag Description
lsrR b1512 lsr operon transcriptional repressor
lsrK b1511 autoinducer-2 (AI-2) kinase
lsrA b1513 Autoinducer 2 import ATP-binding protein
lsrC b1514 Autoinducer 2 import system permease protein
lsrD b1515 autoinducer 2 import system permease protein
lsrB b1516 autoinducer 2-binding protein
lsrF b1517 putative autoinducer-2 (AI-2) aldolase
lsrG b1518 autoinducer-2 (AI-2) degrading protein LsrG