Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004360
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACAACAGCTAGTTGAAAACGTGACAACGTCACTGAGGCAATCATGAAACCAC + [1617970, 1618022] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... marB marA marR eamA
Gene Locus tag Description
marB b1532 predicted protein
marA b1531 DNA-binding transcriptional dual activator of multiple antibiotic resistance
marR b1530 DNA-binding transcriptional repressor of multiple antibiotic resistance
eamA b1533 cysteine and O-acetyl-L-serine efflux system