Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004370
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAACGGCTTGTGCGTAGGAAGTGACAACGTCACGCATAACATGACCGTTTTCT + [1628328, 1628380] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydfI ydfZ ydfJ ydfK
Gene Locus tag Description
ydfI b1542 predicted D-mannonate oxidoreductase, NAD-dependent
ydfZ b1541 selenoprotein, function unknown
ydfJ b4600 pseudo
ydfK b1544 cold shock protein, function unknown, Qin prophage