Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004380
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCGCAATCCGGCAATAATAGGTTACAGTGTCACGTTTTTTTATCTCTTAAAGC + [1663179, 1663231] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dmsD ynfH ynfG ynfF clcB ynfK
Gene Locus tag Description
dmsD b1591 twin-argninine leader-binding protein for DmsA and TorA
ynfH b1590 oxidoreductase, membrane subunit
ynfG b1589 oxidoreductase, Fe-S subunit
ynfF b1588 S- and N-oxide reductase, A subunit, periplasmic
clcB b1592 chloride channel, voltage-gated
ynfK b1593 predicted dethiobiotin synthetase