Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004390
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGCATCCAGCTCTCGCGCTTGTGACAGTGTCACGGTAAAGGGTTTATCAACGA + [1702006, 1702058] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydgJ add blr
Gene Locus tag Description
ydgJ b1624 predicted oxidoreductase
add b1623 adenosine deaminase
blr b4409 beta-lactam resistance membrane protein