Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000043b0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGACCTGGCTTTCACGCGAAGTGACAATGTCACAGGATGCATTACTTGCCGCA + [1155502, 1155554] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... holB tmk yceG pabC ycfH
Gene Locus tag Description
holB b1099 DNA polymerase III, delta prime subunit
tmk b1098 thymidylate kinase
yceG b1097 predicted aminodeoxychorismate lyase
pabC b1096 4-amino-4-deoxychorismate lyase component of para-aminobenzoate synthase multienzyme complex
ycfH b1100 predicted DNAse