Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000043c0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATATGCGTCACACTTTTCTGGTGACAACGTCACAAAATGGCGGTCGTCAATCG + [1763217, 1763269] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydiI ydiH ydiJ
Gene Locus tag Description
ydiI b1686 acyl-CoA esterase in vitro
ydiH b1685 predicted protein
ydiJ b1687 predicted FAD-linked oxidoreductase