Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000043d0
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAACTTTACGGTGGATAAAGGTGACATTGTCACGTTAATGGGGCCGTCTGGCT + [1836830, 1836882] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ynjD ynjC ynjB ynjA ydjZ ydjY ydjX ynjE ynjF
Gene Locus tag Description
ynjD b1756 predicted transporter subunit: ATP-binding component of ABC superfamily
ynjC b1755 Predicted inner membrane ABC transporter permease, function unknown
ynjB b1754 conserved protein
ynjA b1753 conserved protein
ydjZ b1752 Inner membrane protein, TVP38/TMEM64 family
ydjY b1751 predicted protein
ydjX b1750 inner membrane protein, TVP38/TMEM64 family
ynjE b1757 predicted thiosulfate sulfur transferase
ynjF b1758 inner membrane protein, phosphatidylglycerophosphate synthase homolog