Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004400
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GATGCAACGTCTGGAACAAGGTGACGTTGTCACCGAAACTCAGCTTGCCCGGC + [1261196, 1261248] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... prs ispE lolB
Gene Locus tag Description
prs b1207 phosphoribosylpyrophosphate synthase
ispE b1208 4-diphosphocytidyl-2-C-methylerythritol kinase
lolB b1209 OM lipoprotein required for localization of lipoproteins