Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004410
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCCGGAAAGTGCCTGGATTGTGACAGTGTCACCTAAAGCTGTAATGCGCAGC + [1320745, 1320797] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... trpE trpD trpC trpB trpA trpL
Gene Locus tag Description
trpE b1264 component I of anthranilate synthase
trpD b1263 fused glutamine amidotransferase (component II) of anthranilate synthase/anthranilate phosphoribosyl transferase
trpC b1262 fused indole-3-glycerolphosphate synthetase/N-(5-phosphoribosyl)anthranilate isomerase
trpB b1261 tryptophan synthase, beta subunit
trpA b1260 tryptophan synthase, alpha subunit
trpL b1265 trp operon leader peptide