Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004420
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCGACCTGGTCGATCTTGGCATGACACTGTCACCTGCAGATTATGCAGAACGT + [1340351, 1340403] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pyrF yciM yciS yciH
Gene Locus tag Description
pyrF b1281 orotidine-5'-phosphate decarboxylase
yciM b1280 TPR-repeats-containing protein
yciS b1279 inner membrane DUF1049 protein YciS
yciH b1282 initiation factor function partial mimic, SUI1 family