Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004460
Genome
Escherichia coli - NC_000913.2
TF
MatP [UniProtKB:P0A8N0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACTAATGAGTCATGAATGGTGACGCTGTCACTTATATATGCACCCTGGCTG + [1498113, 1498165] 18984159 Experimental technique details ChIP-chip (ECO:0006007) - 168

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydcK rimL tehA tehB
Gene Locus tag Description
ydcK b1428 predicted enzyme
rimL b1427 ribosomal-protein-L7/L12-serine acetyltransferase
tehA b1429 potassium-tellurite ethidium and proflavin transporter
tehB b1430 tellurite resistance protein, SAM-dependent; predicted S-adenosyl-L-methionine-dependent methyltransferase