Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000046e0
Genome
Aliivibrio fischeri - NC_011186.1
TF
LuxR [UniProtKB:B5EV73, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACCTGTAGGATCGTACAGGT - [1162445, 1162464] 17400743 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - 192

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VFMJ11_A1042 VFMJ11_A1043 VFMJ11_A1044
Gene Locus tag Description
VFMJ11_A1042 VFMJ11_A1042 autoinducer synthesis protein LuxI
VFMJ11_A1043 VFMJ11_A1043 transcriptional activator protein LuxR
VFMJ11_A1044 VFMJ11_A1044 MscS mechanosensitive ion channel