Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000048f0
Genome
Helicobacter pylori - NC_011333.1
TF
Fur [UniProtKB:B5Z6G7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCCAAAGTTTCTAATCTTTTC + [430378, 430399] 12421315 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Western blot (quantitative) expression analysis (ECO:0000279) - 228

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HPG27_401 fliY-1 HPG27_399 HPG27_400 fliM HPG27_402 HPG27_403 HPG27_404
Gene Locus tag Description
HPG27_401 HPG27_401 ferric uptake regulation protein
fliY-1 HPG27_398 flagellar motor switch protein FliY
HPG27_399 HPG27_399 hypothetical protein
HPG27_400 HPG27_400 hypothetical protein
fliM HPG27_397 flagellar motor switch protein FliM
HPG27_402 HPG27_402 recombination factor protein RarA
HPG27_403 HPG27_403 putative heatshock protein
HPG27_404 HPG27_404 co-chaperone-curved DNA binding protein A