Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004bf0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATGTGATCTAGATCACATTT + [1557882, 1557903] 9190808 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 246

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lasR rsaL PA1429
Gene Locus tag Description
lasR PA1430 transcriptional regulator LasR
rsaL PA1431 regulatory protein RsaL
PA1429 PA1429 cation-transporting P-type ATPase