Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004eb0
Genome
Neisseria gonorrhoeae - NC_002946.2
TF
Fur [UniProtKB:Q5F5Y9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATAATAGAAGATTGCAATTT + [445480, 445500] 12081969 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 269

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... NGO0449 NGO0451
Gene Locus tag Description
NGO0449 NGO0449 hypothetical protein
NGO0451 NGO0451 replicative DNA helicase