Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004ff0
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGCGGTGAAGATGTCTGCACACGCT + [3533249, 3533274] 19781550 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 281

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_3122 PP_3121 PP_3120 PP_3123
Gene Locus tag Description
PP_3122 PP_3122 3-oxoacid CoA-transferase subunit A
PP_3121 PP_3121 LysR family transcriptional regulator
PP_3120 PP_3120 aldo/keto reductase
PP_3123 PP_3123 3-oxoacid CoA-transferase subunit B