Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005000
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGGTTGTCGAGGATGTGTTCGACGTG - [3891176, 3891201] 19781550 Experimental technique details Beta-gal reporter assay - Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 282

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_3434 PP_3435 hpd PP_3432 rarD-2 PP_3437
Gene Locus tag Description
PP_3434 PP_3434 hypothetical protein
PP_3435 PP_3435 diguanylate phosphodiesterase
hpd PP_3433 4-hydroxyphenylpyruvate dioxygenase
PP_3432 PP_3432 hypothetical protein
rarD-2 PP_3436 RarD protein, DMT superfamily transporter
PP_3437 PP_3437 hypothetical protein