Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005020
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCGGAGCAAATTACGTTATTCGTAAT - [5244514, 5244539] 19781550 Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 283

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hmgA PP_4620 PP_4619 PP_4618 PP_4622 PP_4623
Gene Locus tag Description
hmgA PP_4621 homogentisate 1,2-dioxygenase
PP_4620 PP_4620 fumarylacetoacetase
PP_4619 PP_4619 maleylacetoacetate isomerase
PP_4618 PP_4618 hypothetical protein
PP_4622 PP_4622 IclR family transcriptional regulator
PP_4623 PP_4623 hypothetical protein