Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005030
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTGCGGTCATGGTGGCGTTACTCGTA + [2365429, 2365454] 19781550 Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 283

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lysA-1 PP_2076 PP_2075 PP_2078
Gene Locus tag Description
lysA-1 PP_2077 diaminopimelate decarboxylase
PP_2076 PP_2076 hypothetical protein
PP_2075 PP_2075 hypothetical protein
PP_2078 PP_2078 LysR family transcriptional regulator