Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005040
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAGTGGTAATTAGAGGTTCACAAAGG + [3225585, 3225610] 19781550 Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 283

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mexT PP_2825 PP_2827
Gene Locus tag Description
mexT PP_2826 transcriptional regulator MexT
PP_2825 PP_2825 integrase
PP_2827 PP_2827 zinc-containing alcohol dehydrogenase