Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005050
Genome
Pseudomonas putida - NC_002947.3
TF
PhhR [UniProtKB:Q88EH4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACAAGTGATACACGATTGACGACCA + [3719663, 3719688] 19781550 Experimental technique details Isothermal titration calorimetry (ECO:0005647) - Experimental technique details PSSM site search (ECO:0005659) - 284

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PP_3284 phaB paaC PP_3281 phaD phaM
Gene Locus tag Description
PP_3284 PP_3284 enoyl-CoA hydratase
phaB PP_3283 enoyl-CoA hydratase
paaC PP_3282 3-hydroxyacyl-CoA dehydrogenase
PP_3281 PP_3281 phenylacetic acid degradation protein PaaD
phaD PP_3280 beta-ketoadipyl CoA thiolase
phaM PP_3285 phenylacetic acid degradation protein PaaY