Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000053c0
Genome
Corynebacterium glutamicum - NC_003450.3
TF
Zur [UniProtKB:Q8NNC4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTGAAAATGATTCCCAAAA - [711619, 711639] 20055984 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 305

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... NCgl0662 NCgl0663
Gene Locus tag Description
NCgl0662 NCgl0662 G3E family GTPase
NCgl0663 NCgl0663 thioredoxin reductase