Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000058b0
Genome
Xanthomonas campestris - NC_007086.1
TF
Zur [UniProtKB:Q8PAL3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGTGTTATAAAGTAACACTAGTCGCG + [2990702, 2990728] 18586823 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RACE PCR (ECO:0005661) - 327

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_2472 XC_2471 XC_2473
Gene Locus tag Description
XC_2472 XC_2472 N-acetylmuramoyl-L-alanine amidase
XC_2471 XC_2471 GTP cyclohydrolase
XC_2473 XC_2473 hypothetical protein