Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000058c0
Genome
Xanthomonas campestris - NC_007086.1
TF
Zur [UniProtKB:Q8PAL3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGCGAGTTGTTATACAGTAACATTTCTAG + [321410, 321438] 18586823 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details RACE PCR (ECO:0005661) - 328

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_0267 XC_0266
Gene Locus tag Description
XC_0267 XC_0267 nitrile hydratase activator
XC_0266 XC_0266 hypothetical protein