Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005930
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAAGCGAACATACATTCTTTT + [1330983, 1331003] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 337

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo1302 lmo1303 lmo1301 lmo1300
Gene Locus tag Description
lmo1302 lmo1302 highly similar to SOS response regulator lexA, transcription repressor protein
lmo1303 lmo1303 similar to B. subtilis YneA protein
lmo1301 lmo1301 hypothetical protein
lmo1300 lmo1300 similar to arsenic efflux pump protein