Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006000
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATCTTTATAATAATCATTCTCGTTTACGTT + [167424, 167454] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mrcB fhuA fhuC fhuB fhuD
Gene Locus tag Description
mrcB b0149 fused glycosyl transferase and transpeptidase
fhuA b0150 ferrichrome outer membrane transporter
fhuC b0151 iron-hydroxamate transporter subunit
fhuB b0153 fused iron-hydroxamate transporter subunits of ABC superfamily: membrane components
fhuD b0152 iron-hydroxamate transporter subunit