Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006050
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCGTAAAGTGATAATGATTATCATCTACATA + [1634609, 1634639] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ydfO ynfO pinQ tfaQ stfQ nohQ
Gene Locus tag Description
ydfO b1549 Qin prophage; predicted protein
ynfO b4533 hypothetical protein, Qin prophage
pinQ b1545 Qin prophage; predicted site-specific recombinase
tfaQ b1546 Qin prophage; predicted tail fibre assembly protein
stfQ b1547 Qin prophage; predicted side tail fibre assembly protein
nohQ b1548 pseudo