Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006070
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACATAAATGAAAATAATTATCATTACAGTA + [2066596, 2066626] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... insC insD yoeA yoeH
Gene Locus tag Description
insC b1997 IS2 repressor TnpA
insD b1996 IS2 transposase TnpB
yoeA b4582 pseudo
yoeH b4641 pseudo