Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006090
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACAATAAAAATAATCAGTAATATTAAATAG + [3272852, 3272882] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... agaR yhaV prlF garD rnpB garK garR garL garP
Gene Locus tag Description
agaR b3131 DNA-binding transcriptional repressor of the aga regulon
yhaV b3130 toxin of the SohB(PrlF)-YhaV toxin-antitoxin system
prlF b3129 antitoxin of the SohA(PrlF)-YhaV toxin-antitoxin system
garD b3128 (D)-galactarate dehydrogenase
rnpB b3123 ncRNA
garK b3124 glycerate kinase I
garR b3125 tartronate semialdehyde reductase
garL b3126 alpha-dehydro-beta-deoxy-D-glucarate aldolase
garP b3127 predicted (D)-galactarate transporter