Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000060a0
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTTTTAATGTGAATTATTTCCATACAACTA + [3453693, 3453723] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... bfd bfr gspO gspM gspL gspK gspJ gspI gspH gspG gspF gspE gspD gspB gspA gspC
Gene Locus tag Description
bfd b3337 bacterioferritin-associated ferredoxin
bfr b3336 bacterioferritin, iron storage and detoxification protein
gspO b3335 bifunctional prepilin leader peptidase/ methylase
gspM b3334 general secretory pathway component, cryptic
gspL b3333 general secretory pathway component, cryptic
gspK b3332 general secretory pathway component, cryptic
gspJ b3331 predicted general secretory pathway component, cryptic
gspI b3330 general secretory pathway component, cryptic
gspH b3329 predicted general secretory pathway component, cryptic
gspG b3328 pseudopilin, cryptic, general secretion pathway
gspF b3327 general secretory pathway component, cryptic
gspE b3326 general secretory pathway component, cryptic
gspD b3325 general secretory pathway component, cryptic
gspB b3322 part of gsp divergon involved in type II protein secretion
gspA b3323 general secretory pathway component, cryptic
gspC b3324 general secretory pathway component, cryptic