Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000060b0
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGAGACAATAATAATCATTCTCATTCGCACT + [3579039, 3579069] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yhhY yhhW yhhX ryhB
Gene Locus tag Description
yhhY b3441 predicted acetyltransferase
yhhW b3439 quercetinase activity in vitro
yhhX b3440 predicted oxidoreductase with NAD(P)-binding Rossmann-fold domain
ryhB b4451 ncRNA