Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007420
Genome
Synechocystis sp. PCC 6803 - NC_020286.1
TF
LexA [UniProtKB:P73722, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACAACACCCAGAACCTAGTAACTAGTTCGACTTACCCTCCTTTCTTCG - [1677676, 1677724] 16238629 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details MALDI-TOF Mass Spectrometry (ECO:0005527) - 375

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... MYO_115360 MYO_115370 hoxH MYO_115300 MYO_115310 hoxY hoxU MYO_115340 hoxF
Gene Locus tag Description
MYO_115360 MYO_115360 putative NAD-reducing hydrogenase subunit
MYO_115370 MYO_115370 transposase
hoxH MYO_115290 hydrogenase large subunit
MYO_115300 MYO_115300 hypothetical protein
MYO_115310 MYO_115310 hypothetical protein
hoxY MYO_115320 hydrogenase small subunit
hoxU MYO_115330 hydrogenase subunit
MYO_115340 MYO_115340 hypothetical protein
hoxF MYO_115350 hydrogenase subunit