Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000079a0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTTGTTGTTTCATTGTTAAAAA + [3717209, 3717231] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 394

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yiaG yiaD ghrB yiaF
Gene Locus tag Description
yiaG b3555 predicted transcriptional regulator, HTH_CROC1 family
yiaD b3552 multicopy suppressor of bamB; outer membrane lipoprotein
ghrB b3553 glyoxylate/hydroxypyruvate reductase B
yiaF b3554 conserved protein