Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000079e0
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCTGGTTTATCGTTGGTTTAATT + [4699379, 4699401] 15703297 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 398

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mgtA STM4463 pyrL pyrB pyrI yjgF STM4457 treB treR treC STM4452.1N
Gene Locus tag Description
mgtA STM4456 magnesium-transporting ATPase MgtA
STM4463 STM4463 arginine repressor
pyrL STM4461 pyrBI operon leader peptide
pyrB STM4460 aspartate carbamoyltransferase catalytic subunit
pyrI STM4459 aspartate carbamoyltransferase regulatory subunit
yjgF STM4458 translation initiation inhibitor
STM4457 STM4457 transposase
treB STM4454 pseudo
treR STM4455 trehalose repressor
treC STM4453 trehalose-6-phosphate hydrolase
STM4452.1N STM4452.1N hypothetical protein