Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007a10
Genome
Salmonella enterica - NC_003197.1
TF
PhoP [UniProtKB:P0DM78, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCATGTTTAAACACGCTTTATTT - [3965270, 3965292] 15703297 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 398

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mgtC STM3766 yicL
Gene Locus tag Description
mgtC STM3764 Mg2+ transport protein
STM3766 STM3766 hypothetical protein
yicL STM3765 permease