Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00009440
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATTGTATACAGTATACTAAA + [1191973, 1191994] 19939938 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 456

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gltA GSU1105 GSU1104 GSU1103 GSU1107 GSU1108
Gene Locus tag Description
gltA GSU1106 type I citrate synthase
GSU1105 GSU1105 prolidase family protein
GSU1104 GSU1104 lipoprotein
GSU1103 GSU1103 AMP-binding protein
GSU1107 GSU1107 AMMECR1 family protein
GSU1108 GSU1108 aldehyde dehydrogenase